Primer dissolution and dilution method

When conducting molecular cloning experiments in the laboratory, it is often necessary to synthesize a large number of primers, and these synthetic primers must first be appropriately diluted before use. If primers are used without dilution, they often result in wasted primers and premature loss of activity, and some are contaminated and cannot be used. Therefore, it is recommended to dilute the synthetic primers before use. The diluted primer is conducive to storage and application.

The method is briefly described as follows:

1. Oligo DNA is calculated in OD260 units, which means that in a 1ml volume 1cm light path standard cuvette, an Oligo solution with an absorbance of 1A260 at a wavelength of 260nm is defined as 1 OD260 unit. At 33μg of Oligo DNA, you can calculate the number of moles based on this data and the molecular weight of your Oligo DNA to calculate solutions with different molar concentrations.

2. The formula for calculating the molecular weight of the primer sequence is as follows:

MW = (A base number × 312) + (C base number × 288) + (G base number × 328) + (T base number × 303) -61

For example: Primer TGGGCGGCGGTTGGTGTTACG A = 1 C = 3 G = 11 T = 6

MW = (1 × 312) + (3 × 328) + (6 × 303) -61 = 6541

3. The molecular weight of Oligo DNA can also be calculated by the following approximate method: the average molecular weight of each deoxynucleotide base in Oligo DNA is approximately 324.5, then the molecular weight of an Oligo DNA = the number of bases × 324.5.

example:

You get a tube of 20 mer Oligo DNA labeled 5 OD260

Molecular weight = 20 × 324.5 = 6490

Mass number = 5 × 33 = 165μg

Molars = 165/6490 = 0.025μmol = 25nmol

If adding 400μl of sterilized double distilled water to dissolve, the concentration is 25nmol / 400μl = 62.5μM

4. Eppendorf tubes with primers are generally stored at -20 ℃ and diluted before use.

5. Because Oligo DNA is attached to the tube wall as a light dry film, it is easily lost when opened, so please centrifuge at 10,000rpm for 1min before opening the tube, and then slowly open the cap.

6. Add 100-500μl of double-distilled water to the eppendorf tube equipped with primers, close the tube cover, shake up and down for 5-10 minutes, and centrifuge again at 10,000rpm for 1min.

7. Calculate the primer concentration of the original primer tube (if necessary, measure OD260 to check whether the amount of primer provided by the manufacturer is correct).

8. Calculate and dilute the primer to 10 pmol / μl.

9. Indicate the original primer tube, application primer tube, and dilution method, and store at -20 ℃.

CONTUO Height Adjustable Desk  can always meet the customers` demands well.  Electric Height Adjustable Desk, Standing Desk Converter,Movable Standing Desk ,  , Also the Hand Crank Desk , Tv Stand / Cart, Lifting Column , Standing Desk Accessory  for special customers, so customers here can get what they want very easily with happiness.
Single-motor electric height adjustable frame (CTT-D02) from CONTUO allows you to create your own desk space and find that much needed healthy balance of sitting and standing throughout the long work day. Poor posture puts unnecessary and unhealthy strain on your back and neck, but the Electric Desk frame elevates your workstation to an ergonomic height while encouraging healthy movement. Standing periodically throughout the day keeps the blood flowing.

Electric Height Adjustable Desk

Powerful Lift System
Elevate your workstation to your ideal position with the powerful, silent, and smooth single motor lift system. The single motor frame creates a 1.5" per second lift speed. The elegant controller touch screen features customizable settings for desired user heights. This desk comes with overload and heat protection. Duty Cycle: 10%, Max. 2 minutes on/18 minutes off.

Telescopic Height Adjustment
The solidly constructed steel legs utilize telescopic height adjustment. This ensures that the transition to your ideal, ergonomic position takes place in a matter of seconds with a simple touch.

Single Motor Standing Desk

Single Motor Standing Desk,Adjustable Table,Adjustable Computer Desk,Height Adjustable Table

Shaoxing contuo Transmission Technology Co.,Ltd , https://www.electricdesk.nl